The Genomic Standards Consortium (GSC) is an open-membership working body formed in September 2005. The aim of the GSC is making genomic data discoverable. The GSC enables genomic data integration, discovery and comparison through international community-driven standards.
This project is maintained by cmungall
Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters
URI: mixs.vocab:adapters
None -> OPT String
| Aliases: | adapters | |
| Comments: | Expected value: adapter A and B sequence | |
| Position: 48.0 | ||
| Examples: | Example(value=’AATGATACGGCGACCACCGAGATCTACACGCT;CAAGCAGAAGACGGCATACGAGAT’, description=None) |