Class: core

Core package. Do not use this directly, this is used to build other packages

URI: mixs.vocab:Core

Attributes

Own

• submitted_to_insdc _0..1
  • Description: Depending on the study (large-scale e.g. done with next generation sequencing technology, or small-scale) sequences have to be submitted to SRA (Sequence Read Archive), DRA (DDBJ Read Archive) or via the classical Webin/Sequin systems to Genbank, ENA and DDBJ. Although this field is mandatory, it is meant as a self-test field, therefore it is not necessary to include this field in contextual data submitted to databases
  • Range: String
  • Example: yes None
• investigation_type _0..1
  • Description: Nucleic Acid Sequence Report is the root element of all MIGS/MIMS compliant reports as standardized by Genomic Standards Consortium. This field is either eukaryote,bacteria,virus,plasmid,organelle, metagenome,mimarks-survey, mimarks-specimen, metatranscriptome, single amplified genome, metagenome-assembled genome, or uncultivated viral genome
  • Range: investigation_type_enum
  • Example: metagenome None
• samp_name _0..1
  • Description: A local identifier or name that for the material sample used for extracting nucleic acids, and subsequent sequencing. It can refer either to the original material collected or to any derived sub-samples. It can have any format, but we suggest that you make it concise, unique and consistent within your lab, and as informative as possible. INSDC requires every sample name from a single Submitter to be unique. Use of a globally unique identifier for the field source_mat_id is recommended in addition to sample_name.
  • Range: String
  • Example: ISDsoil1 None
• samp_taxon_id _0..1
  • Description: NCBI taxon id of the sample. Maybe be a single taxon or mixed taxa sample. Use 'synthetic metagenome’ for mock community/positive controls, or 'blank sample' for negative controls.
  • Range: String
  • Example: Gut Metagenome [NCBI:txid749906] None
• project_name _0..1
  • Description: Name of the project within which the sequencing was organized
  • Range: String
  • Example: Forest soil metagenome None
• experimental_factor _0..1
  • Description: Experimental factors are essentially the variable aspects of an experiment design which can be used to describe an experiment, or set of experiments, in an increasingly detailed manner. This field accepts ontology terms from Experimental Factor Ontology (EFO) and/or Ontology for Biomedical Investigations (OBI). For a browser of EFO (v 2.95) terms, please see http://purl.bioontology.org/ontology/EFO; for a browser of OBI (v 2018-02-12) terms please see http://purl.bioontology.org/ontology/OBI
  • Range: String
  • Example: time series design [EFO:EFO_0001779] None
• lat_lon _0..1
  • Description: The geographical origin of the sample as defined by latitude and longitude. The values should be reported in decimal degrees and in WGS84 system
  • Range: String
  • Example: 50.586825 6.408977 None
• depth _0..1
  • Description: The vertical distance below local surface, e.g. for sediment or soil samples depth is measured from sediment or soil surface, respectively. Depth can be reported as an interval for subsurface samples.
  • Range: QuantityValue
  • Example: 10 meter None
• alt _0..1
  • Description: Altitude is a term used to identify heights of objects such as airplanes, space shuttles, rockets, atmospheric balloons and heights of places such as atmospheric layers and clouds. It is used to measure the height of an object which is above the earth's surface. In this context, the altitude measurement is the vertical distance between the earth's surface above sea level and the sampled position in the air
  • Range: QuantityValue
  • Example: 100 meter None
• elev _0..1
  • Description: Elevation of the sampling site is its height above a fixed reference point, most commonly the mean sea level. Elevation is mainly used when referring to points on the earth's surface, while altitude is used for points above the surface, such as an aircraft in flight or a spacecraft in orbit.
  • Range: QuantityValue
  • Example: 100 meter None
• temp _0..1
  • Description: Temperature of the sample at the time of sampling.
  • Range: QuantityValue
  • Example: 25 degree Celsius None
• geo_loc_name _0..1
  • Description: The geographical origin of the sample as defined by the country or sea name followed by specific region name. Country or sea names should be chosen from the INSDC country list (http://insdc.org/country.html), or the GAZ ontology (http://purl.bioontology.org/ontology/GAZ)
  • Range: String
  • Example: USA: Maryland, Bethesda None
• collection_date _0..1
  • Description: The time of sampling, either as an instance (single point in time) or interval. In case no exact time is available, the date/time can be right truncated i.e. all of these are valid times: 2008-01-23T19:23:10+00:00; 2008-01-23T19:23:10; 2008-01-23; 2008-01; 2008; Except: 2008-01; 2008 all are ISO8601 compliant
  • Range: Date
  • Example: 2018-05-11T10:00:00+01:00; 2018-05-11 None
• env_broad_scale _0..1
  • Description: Report the major environmental system the sample or specimen came from. The system(s) identified should have a coarse spatial grain, to provide the general environmental context of where the sampling was done (e.g. in the desert or a rainforest). We recommend using subclasses of EnvO’s biome class: http://purl.obolibrary.org/obo/ENVO_00000428. EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS
  • Range: String
  • Example: oceanic epipelagic zone biome [ENVO:01000033] for annotating a water sample from the photic zone in middle of the Atlantic Ocean None
• env_local_scale _0..1
  • Description: Report the entity or entities which are in the sample or specimen’s local vicinity and which you believe have significant causal influences on your sample or specimen. We recommend using EnvO terms which are of smaller spatial grain than your entry for env_broad_scale. Terms, such as anatomical sites, from other OBO Library ontologies which interoperate with EnvO (e.g. UBERON) are accepted in this field. EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS
  • Range: String
  • Example: litter layer [ENVO:01000338]; Annotating a pooled sample taken from various vegetation layers in a forest consider: canopy [ENVO:00000047]|herb and fern layer [ENVO:01000337]|litter layer [ENVO:01000338]|understory [01000335]|shrub layer [ENVO:01000336]. None
• env_medium _0..1
  • Description: Report the environmental material(s) immediately surrounding the sample or specimen at the time of sampling. We recommend using subclasses of 'environmental material' (http://purl.obolibrary.org/obo/ENVO_00010483). EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS . Terms from other OBO ontologies are permissible as long as they reference mass/volume nouns (e.g. air, water, blood) and not discrete, countable entities (e.g. a tree, a leaf, a table top).
  • Range: String
  • Example: soil [ENVO:00001998]; Annotating a fish swimming in the upper 100 m of the Atlantic Ocean, consider: ocean water [ENVO:00002151]. Example: Annotating a duck on a pond consider: pond water [ENVO:00002228]|air [ENVO_00002005] None
• env_package _0..1
  • Description: MIxS extension for reporting of measurements and observations obtained from one or more of the environments where the sample was obtained. All environmental packages listed here are further defined in separate subtables. By giving the name of the environmental package, a selection of fields can be made from the subtables and can be reported
  • Range: env_package_enum
  • Example: soil None
• subspecf_gen_lin _0..1
  • Description: Information about the genetic distinctness of the sequenced organism below the subspecies level, e.g., serovar, serotype, biotype, ecotype, or any relevant genetic typing schemes like Group I plasmid. Subspecies should not be recorded in this term, but in the NCBI taxonomy. Supply both the lineage name and the lineage rank separated by a colon, e.g., biovar:abc123.
  • Range: String
  • Example: serovar:Newport None
• ploidy _0..1
  • Description: The ploidy level of the genome (e.g. allopolyploid, haploid, diploid, triploid, tetraploid). It has implications for the downstream study of duplicated gene and regions of the genomes (and perhaps for difficulties in assembly). For terms, please select terms listed under class ploidy (PATO:001374) of Phenotypic Quality Ontology (PATO), and for a browser of PATO (v 2018-03-27) please refer to http://purl.bioontology.org/ontology/PATO
  • Range: String
  • Example: allopolyploidy [PATO:0001379] None
• num_replicons _0..1
  • Description: Reports the number of replicons in a nuclear genome of eukaryotes, in the genome of a bacterium or archaea or the number of segments in a segmented virus. Always applied to the haploid chromosome count of a eukaryote
  • Range: Integer
  • Example: 2 None
• extrachrom_elements _0..1
  • Description: Do plasmids exist of significant phenotypic consequence (e.g. ones that determine virulence or antibiotic resistance). Megaplasmids? Other plasmids (borrelia has 15+ plasmids)
  • Range: Integer
  • Example: 5 None
• estimated_size _0..1
  • Description: The estimated size of the genome prior to sequencing. Of particular importance in the sequencing of (eukaryotic) genome which could remain in draft form for a long or unspecified period.
  • Range: String
  • Example: 300000 bp None
• ref_biomaterial _0..1
  • Description: Primary publication if isolated before genome publication; otherwise, primary genome report.
  • Range: String
  • Example: doi:10.1016/j.syapm.2018.01.009 None
• source_mat_id _0..1
  • Description: A unique identifier assigned to a material sample (as defined by http://rs.tdwg.org/dwc/terms/materialSampleID, and as opposed to a particular digital record of a material sample) used for extracting nucleic acids, and subsequent sequencing. The identifier can refer either to the original material collected or to any derived sub-samples. The INSDC qualifiers /specimen_voucher, /bio_material, or /culture_collection may or may not share the same value as the source_mat_id field. For instance, the /specimen_voucher qualifier and source_mat_id may both contain 'UAM:Herps:14' , referring to both the specimen voucher and sampled tissue with the same identifier. However, the /culture_collection qualifier may refer to a value from an initial culture (e.g. ATCC:11775) while source_mat_id would refer to an identifier from some derived culture from which the nucleic acids were extracted (e.g. xatc123 or ark:/2154/R2).
  • Range: String
  • Example: MPI012345 None
• pathogenicity _0..1
  • Description: To what is the entity pathogenic
  • Range: String
  • Example: human, animal, plant, fungi, bacteria None
• biotic_relationship _0..1
  • Description: Description of relationship(s) between the subject organism and other organism(s) it is associated with. E.g., parasite on species X; mutualist with species Y. The target organism is the subject of the relationship, and the other organism(s) is the object
  • Range: biotic_relationship_enum
  • Example: free living None
• specific_host _0..1
  • Description: Report the host's taxonomic name and/or NCBI taxonomy ID.
  • Range: String
  • Example: Homo sapiens and/or 9606 None
• host_spec_range _0..1
  • Description: The range and diversity of host species that an organism is capable of infecting, defined by NCBI taxonomy identifier.
  • Range: Integer
  • Example: 9606 None
• health_disease_stat _0..1
  • Description: Health or disease status of specific host at time of collection
  • Range: health_disease_stat_enum
  • Example: dead None
• host_disease_stat _0..1
  • Description: List of diseases with which the host has been diagnosed; can include multiple diagnoses. The value of the field depends on host; for humans the terms should be chosen from the DO (Human Disease Ontology) at https://www.disease-ontology.org, non-human host diseases are free text
  • Range: String
  • Example: rabies [DOID:11260] None
• trophic_level _0..1
  • Description: Trophic levels are the feeding position in a food chain. Microbes can be a range of producers (e.g. chemolithotroph)
  • Range: trophic_level_enum
  • Example: heterotroph None
• propagation _0..1
  • Description: The type of reproduction from the parent stock. Values for this field is specific to different taxa. For phage or virus: lytic/lysogenic/temperate/obligately lytic. For plasmids: incompatibility group. For eukaryotes: sexual/asexual.
  • Range: String
  • Example: lytic None
• encoded_traits _0..1
  • Description: Should include key traits like antibiotic resistance or xenobiotic degradation phenotypes for plasmids, converting genes for phage
  • Range: String
  • Example: beta-lactamase class A None
• rel_to_oxygen _0..1
  • Description: Is this organism an aerobe, anaerobe? Please note that aerobic and anaerobic are valid descriptors for microbial environments
  • Range: rel_to_oxygen_enum
  • Example: aerobe None
• isol_growth_condt _0..1
  • Description: Publication reference in the form of pubmed ID (pmid), digital object identifier (doi) or url for isolation and growth condition specifications of the organism/material
  • Range: String
  • Example: doi: 10.1016/j.syapm.2018.01.009 None
• samp_collec_device _0..1
  • Description: The device used to collect an environmental sample. This field accepts terms listed under environmental sampling device (http://purl.obolibrary.org/obo/ENVO). This field also accepts terms listed under specimen collection device (http://purl.obolibrary.org/obo/GENEPIO_0002094).
  • Range: String
  • Example: swab, biopsy, niskin bottle, push core, drag swab [GENEPIO:0002713] None
• samp_collec_method _0..1
  • Description: The method employed for collecting the sample.
  • Range: String
  • Example: swabbing None
• samp_mat_process _0..1
  • Description: A brief description of any processing applied to the sample during or after retrieving the sample from environment, or a link to the relevant protocol(s) performed.
  • Range: String
  • Example: filtering of seawater, storing samples in ethanol None
• size_frac _0..1
  • Description: Filtering pore size used in sample preparation
  • Range: String
  • Example: 0-0.22 micrometer None
• samp_size _0..1
  • Description: The total amount or size (volume (ml), mass (g) or area (m2) ) of sample collected.
  • Range: QuantityValue
  • Example: 5 liter None
• samp_vol_we_dna_ext _0..1
  • Description: Volume (ml) or mass (g) of total collected sample processed for DNA extraction. Note: total sample collected should be entered under the term Sample Size (MIXS:0000001).
  • Range: QuantityValue
  • Example: 1500 milliliter None
• source_uvig _0..1
  • Description: Type of dataset from which the UViG was obtained
  • Range: source_uvig_enum
  • Example: viral fraction metagenome (virome) None
• virus_enrich_appr _0..1
  • Description: List of approaches used to enrich the sample for viruses, if any
  • Range: virus_enrich_appr_enum
  • Example: filtration + FeCl Precipitation + ultracentrifugation + DNAse None
• nucl_acid_ext _0..1
  • Description: A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the material separation to recover the nucleic acid fraction from a sample
  • Range: String
  • Example: https://mobio.com/media/wysiwyg/pdfs/protocols/12888.pdf None
• nucl_acid_amp _0..1
  • Description: A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the enzymatic amplification (PCR, TMA, NASBA) of specific nucleic acids
  • Range: String
  • Example: https://phylogenomics.me/protocols/16s-pcr-protocol/ None
• lib_size _0..1
  • Description: Total number of clones in the library prepared for the project
  • Range: Integer
  • Example: 50 None
• lib_reads_seqd _0..1
  • Description: Total number of clones sequenced from the library
  • Range: Integer
  • Example: 20 None
• lib_layout _0..1
  • Description: Specify whether to expect single, paired, or other configuration of reads
  • Range: lib_layout_enum
  • Example: paired None
• lib_vector _0..1
  • Description: Cloning vector type(s) used in construction of libraries
  • Range: String
  • Example: Bacteriophage P1 None
• lib_screen _0..1
  • Description: Specific enrichment or screening methods applied before and/or after creating libraries
  • Range: String
  • Example: enriched, screened, normalized None
• target_gene _0..1
  • Description: Targeted gene or locus name for marker gene studies
  • Range: String
  • Example: 16S rRNA, 18S rRNA, nif, amoA, rpo None
• target_subfragment _0..1
  • Description: Name of subfragment of a gene or locus. Important to e.g. identify special regions on marker genes like V6 on 16S rRNA
  • Range: String
  • Example: V6, V9, ITS None
• pcr_primers _0..1
  • Description: PCR primers that were used to amplify the sequence of the targeted gene, locus or subfragment. This field should contain all the primers used for a single PCR reaction if multiple forward or reverse primers are present in a single PCR reaction. The primer sequence should be reported in uppercase letters
  • Range: String
  • Example: FWD:GTGCCAGCMGCCGCGGTAA;REV:GGACTACHVGGGTWTCTAAT None
• mid _0..1
  • Description: Molecular barcodes, called Multiplex Identifiers (MIDs), that are used to specifically tag unique samples in a sequencing run. Sequence should be reported in uppercase letters
  • Range: String
  • Example: GTGAATAT None
• adapters _0..1
  • Description: Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters
  • Range: String
  • Example: AATGATACGGCGACCACCGAGATCTACACGCT;CAAGCAGAAGACGGCATACGAGAT None
• pcr_cond _0..1
  • Description: Description of reaction conditions and components of PCR in the form of 'initial denaturation:94degC_1.5min; annealing=...'
  • Range: String
  • Example: initial denaturation:94_3;annealing:50_1;elongation:72_1.5;final elongation:72_10;35 None
• seq_meth _0..1
  • Description: Sequencing machine used. Where possible the term should be taken from the OBI list of DNA sequencers (http://purl.obolibrary.org/obo/OBI_0400103).
  • Range: String
  • Example: 454 Genome Sequencer FLX [OBI:0000702] None
• seq_quality_check _0..1
  • Description: Indicate if the sequence has been called by automatic systems (none) or undergone a manual editing procedure (e.g. by inspecting the raw data or chromatograms). Applied only for sequences that are not submitted to SRA,ENA or DRA
  • Range: String
  • Example: none None
• chimera_check _0..1
  • Description: Tool(s) used for chimera checking, including version number and parameters, to discover and remove chimeric sequences. A chimeric sequence is comprised of two or more phylogenetically distinct parent sequences.
  • Range: String
  • Example: uchime;v4.1;default parameters None
• tax_ident _0..1
  • Description: The phylogenetic marker(s) used to assign an organism name to the SAG or MAG
  • Range: tax_ident_enum
  • Example: other: rpoB gene None
• assembly_qual _0..1
  • Description: The assembly quality category is based on sets of criteria outlined for each assembly quality category. For MISAG/MIMAG; Finished: Single, validated, contiguous sequence per replicon without gaps or ambiguities with a consensus error rate equivalent to Q50 or better. High Quality Draft:Multiple fragments where gaps span repetitive regions. Presence of the 23S, 16S and 5S rRNA genes and at least 18 tRNAs. Medium Quality Draft:Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Low Quality Draft:Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Assembly statistics include, but are not limited to total assembly size, number of contigs, contig N50/L50, and maximum contig length. For MIUVIG; Finished: Single, validated, contiguous sequence per replicon without gaps or ambiguities, with extensive manual review and editing to annotate putative gene functions and transcriptional units. High-quality draft genome: One or multiple fragments, totaling ≥ 90% of the expected genome or replicon sequence or predicted complete. Genome fragment(s): One or multiple fragments, totalling < 90% of the expected genome or replicon sequence, or for which no genome size could be estimated
  • Range: assembly_qual_enum
  • Example: High-quality draft genome None
• assembly_name _0..1
  • Description: Name/version of the assembly provided by the submitter that is used in the genome browsers and in the community
  • Range: String
  • Example: HuRef, JCVI_ISG_i3_1.0 None
• assembly_software _0..1
  • Description: Tool(s) used for assembly, including version number and parameters
  • Range: String
  • Example: metaSPAdes;3.11.0;kmer set 21,33,55,77,99,121, default parameters otherwise None
• annot _0..1
  • Description: Tool used for annotation, or for cases where annotation was provided by a community jamboree or model organism database rather than by a specific submitter
  • Range: String
  • Example: prokka None
• number_contig _0..1
  • Description: Total number of contigs in the cleaned/submitted assembly that makes up a given genome, SAG, MAG, or UViG
  • Range: Integer
  • Example: 40 None
• feat_pred _0..1
  • Description: Method used to predict UViGs features such as ORFs, integration site, etc.
  • Range: String
  • Example: Prodigal;2.6.3;default parameters None
• ref_db _0..1
  • Description: List of database(s) used for ORF annotation, along with version number and reference to website or publication
  • Range: String
  • Example: pVOGs;5;http://dmk-brain.ecn.uiowa.edu/pVOGs/ Grazziotin et al. 2017 doi:10.1093/nar/gkw975 None
• sim_search_meth _0..1
  • Description: Tool used to compare ORFs with database, along with version and cutoffs used
  • Range: String
  • Example: HMMER3;3.1b2;hmmsearch, cutoff of 50 on score None
• tax_class _0..1
  • Description: Method used for taxonomic classification, along with reference database used, classification rank, and thresholds used to classify new genomes
  • Range: String
  • Example: vConTACT vContact2 (references from NCBI RefSeq v83, genus rank classification, default parameters) None
• x_16s_recover _0..1
  • Description: Can a 16S gene be recovered from the submitted SAG or MAG?
  • Range: String
  • Example: yes None
• trnas _0..1
  • Description: The total number of tRNAs identified from the SAG or MAG
  • Range: Integer
  • Example: 18 None
• trna_ext_software _0..1
  • Description: Tools used for tRNA identification
  • Range: String
  • Example: infernal;v2;default parameters None
• compl_score _0..1
  • Description: Completeness score is typically based on either the fraction of markers found as compared to a database or the percent of a genome found as compared to a closely related reference genome. High Quality Draft: >90%, Medium Quality Draft: >50%, and Low Quality Draft: < 50% should have the indicated completeness scores
  • Range: compl_score_enum
  • Example: med;60% None
• compl_software _0..1
  • Description: Tools used for completion estimate, i.e. checkm, anvi'o, busco
  • Range: String
  • Example: checkm None
• compl_appr _0..1
  • Description: The approach used to determine the completeness of a given genomic assembly, which would typically make use of a set of conserved marker genes or a closely related reference genome. For UViG completeness, include reference genome or group used, and contig feature suggesting a complete genome
  • Range: compl_appr_enum
  • Example: other: UViG length compared to the average length of reference genomes from the P22virus genus (NCBI RefSeq v83) None
• contam_score _0..1
  • Description: The contamination score is based on the fraction of single-copy genes that are observed more than once in a query genome. The following scores are acceptable for; High Quality Draft: < 5%, Medium Quality Draft: < 10%, Low Quality Draft: < 10%. Contamination must be below 5% for a SAG or MAG to be deposited into any of the public databases
  • Range: String
  • Example: 1% None
• contam_screen_input _0..1
  • Description: The type of sequence data used as input
  • Range: String
  • Example: contigs None
• contam_screen_param _0..1
  • Description: Specific parameters used in the decontamination sofware, such as reference database, coverage, and kmers. Combinations of these parameters may also be used, i.e. kmer and coverage, or reference database and kmer
  • Range: contam_screen_param_enum
  • Example: kmer None
• decontam_software _0..1
  • Description: Tool(s) used in contamination screening
  • Range: decontam_software_enum
  • Example: anvi'o None
• sort_tech _0..1
  • Description: Method used to sort/isolate cells or particles of interest
  • Range: sort_tech_enum
  • Example: optical manipulation None
• single_cell_lysis_appr _0..1
  • Description: Method used to free DNA from interior of the cell(s) or particle(s)
  • Range: single_cell_lysis_appr_enum
  • Example: enzymatic None
• single_cell_lysis_prot _0..1
  • Description: Name of the kit or standard protocol used for cell(s) or particle(s) lysis
  • Range: String
  • Example: ambion single cell lysis kit None
• wga_amp_appr _0..1
  • Description: Method used to amplify genomic DNA in preparation for sequencing
  • Range: String
  • Example: mda based None
• wga_amp_kit _0..1
  • Description: Kit used to amplify genomic DNA in preparation for sequencing
  • Range: String
  • Example: qiagen repli-g None
• bin_param _0..1
  • Description: The parameters that have been applied during the extraction of genomes from metagenomic datasets
  • Range: bin_param_enum
  • Example: coverage and kmer None
• bin_software _0..1
  • Description: Tool(s) used for the extraction of genomes from metagenomic datasets, where possible include a product ID (PID) of the tool(s) used.
  • Range: String
  • Example: MetaCluster-TA (RRID:SCR_004599), MaxBin (biotools:maxbin) None
• reassembly_bin _0..1
  • Description: Has an assembly been performed on a genome bin extracted from a metagenomic assembly?
  • Range: String
  • Example: no None
• mag_cov_software _0..1
  • Description: Tool(s) used to determine the genome coverage if coverage is used as a binning parameter in the extraction of genomes from metagenomic datasets
  • Range: mag_cov_software_enum
  • Example: bbmap None
• vir_ident_software _0..1
  • Description: Tool(s) used for the identification of UViG as a viral genome, software or protocol name including version number, parameters, and cutoffs used
  • Range: String
  • Example: VirSorter; 1.0.4; Virome database, category 2 None
• pred_genome_type _0..1
  • Description: Type of genome predicted for the UViG
  • Range: pred_genome_type_enum
  • Example: dsDNA None
• pred_genome_struc _0..1
  • Description: Expected structure of the viral genome
  • Range: pred_genome_struc_enum
  • Example: non-segmented None
• detec_type _0..1
  • Description: Type of UViG detection
  • Range: String
  • Example: independent sequence (UViG) None
• otu_class_appr _0..1
  • Description: Cutoffs and approach used when clustering “species-level” OTUs. Note that results from standard 95% ANI / 85% AF clustering should be provided alongside OTUS defined from another set of thresholds, even if the latter are the ones primarily used during the analysis
  • Range: String
  • Example: 95% ANI;85% AF; greedy incremental clustering None
• otu_seq_comp_appr _0..1
  • Description: Tool and thresholds used to compare sequences when computing "species-level" OTUs
  • Range: String
  • Example: blastn;2.6.0+;e-value cutoff: 0.001 None
• otu_db _0..1
  • Description: Reference database (i.e. sequences not generated as part of the current study) used to cluster new genomes in "species-level" OTUs, if any
  • Range: String
  • Example: NCBI Viral RefSeq;83 None
• host_pred_appr _0..1
  • Description: Tool or approach used for host prediction
  • Range: host_pred_appr_enum
  • Example: CRISPR spacer match None
• host_pred_est_acc _0..1
  • Description: For each tool or approach used for host prediction, estimated false discovery rates should be included, either computed de novo or from the literature
  • Range: String
  • Example: CRISPR spacer match: 0 or 1 mismatches, estimated 8% FDR at the host genus rank (Edwards et al. 2016 doi:10.1093/femsre/fuv048) None
• associated resource _0..1
  • Description: A related resource that is referenced, cited, or otherwise associated to the sequence.
  • Range: String
  • Example: http://www.earthmicrobiome.org/ None
• sop _0..1
  • Description: Standard operating procedures used in assembly and/or annotation of genomes, metagenomes or environmental sequences
  • Range: String
  • Example: http://press.igsb.anl.gov/earthmicrobiome/protocols-and-standards/its/ None